Review



monarch plasmid spin miniprep kit neb cat  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs monarch plasmid spin miniprep kit neb cat
    Monarch Plasmid Spin Miniprep Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 793 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+plasmid+miniprep+kit+neb+cat/Monarch+Spin+Plasmid+Miniprep+Kit/10__1016_slash_j__isci__2026__115975-165-123-128
    Average 99 stars, based on 793 article reviews
    monarch plasmid spin miniprep kit neb cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Membrane:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Cell Culture:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Western Blot:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Plasmid Preparation:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Gel Extraction:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Polymerase Chain Reaction:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Sequencing:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Mutagenesis:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2

    Recombinant:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2



    Similar Products

    monarch plasmid spin miniprep kit neb cat  (New England Biolabs)
    99
    New England Biolabs monarch plasmid spin miniprep kit neb cat
    Monarch Plasmid Spin Miniprep Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+plasmid+miniprep+kit+neb+cat/Monarch+Spin+Plasmid+Miniprep+Kit/10__1016_slash_j__isci__2026__115975-165-123-128
    Average 99 stars, based on 1 article reviews
    monarch plasmid spin miniprep kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    monarch spin plasmid miniprep kit neb cat  (New England Biolabs)
    99
    New England Biolabs monarch spin plasmid miniprep kit neb cat
    Monarch Spin Plasmid Miniprep Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+plasmid+miniprep+kit+neb+cat/Monarch+Spin+Plasmid+Miniprep+Kit/pm40614719-243-187-192
    Average 99 stars, based on 1 article reviews
    monarch spin plasmid miniprep kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    monarch mini prep kit neb cat  (New England Biolabs)
    99
    New England Biolabs monarch mini prep kit neb cat
    Monarch Mini Prep Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+plasmid+miniprep+kit+neb+cat/Monarch+Spin+Plasmid+Miniprep+Kit/pm40527319-1199-62-66
    Average 99 stars, based on 1 article reviews
    monarch mini prep kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results